Seudónimo Seudónimo
  • 18-11-2021
  • Health
contestada

Which term refers to the bones in the toes and fingers?

tarsals

humerus

phalanges

metacarpals

Respuesta :

ItzTds
ItzTds ItzTds
  • 18-11-2021

Answer:

Phalanges {final answer}

Explanation:

The term phalanges refers to the bones in the toes and fingers.

Answer Link

Otras preguntas

Luis has a biweekly gross pay of $770 and claims 2 federal withholding allowances. Luis has all of the following deductions from his gross pay: federal tax from
Joshua cashed a check for $16.79he asked the teller to give him as many quarters as possible .how many quarters did he get
Q1 (a) A random variable X has the following probability function: Х O 1 2 3 4 5 and P(x) 0 k 2k 2k 3k 5k(i) Determine the value of "k" (i)Find P(1.5 < X <
Which one of Aiko's steps makes a false assumption? Why is it false? Aiko's Proof: 1. Draw 2 rectangles. Label one ABCD and the other PQRS 2. Translate rectangl
can someone explain it please?​
A line passes through the points (-2, 9) and (1, 3). Provide work for calculating the slope and y-intercept. Then, write the equation for the line in slope-inte
Which is the sum of two or more different monomials?
Alice isn't sure which labor rate to use for employees in her project budget. Which employee labor rate should you tell her to use?.
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
Heart, 5 stars, and brainliest to first right answer! Please no copy paste or links. Why did the Athens lead Greece into the Persian war? Explain why. (Explanat