cdxxc3434 cdxxc3434

27-12-2021
Biology

contestada

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Respuesta :

taylor11152 taylor11152

27-12-2021

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

Answer Link

Otras preguntas

Convert the temperature from degrees Fahrenheit to degrees Celsius, using the formula

What did Russia, a largely Slavic nation, do after Austria-Hungary declared war on the Slavic nation of Serbia? Question 7 options: declare war on Germany pledg

name all radii, name all radii (no links please) I FALLING IN MATH CLASS! PLEASE HELP ME,

Draw a line representing the "rise" and a line representing the "run" of the line. State the slope of the line in simplest form.

What classical composer is known for having really big hands? (Trivia)

In the 2000 case __________, the Supreme Court ruled that not having a uniform method for recounting votes violated the candidates’ right to equal protection un

6. How did the writing of Petrarch, Boccaccio, and Machiavelli demonstrate the values of humanism?

Today, the price of a new cell phone is $129. In 2000, the price of a similar cell phone was $240. What is the percent of change in the price of a cell phone fr

Which country/countries repeatedly appear(s) on each of the following lists?

Rachel is putting 8 books in a row on her bookshelf. She will put one of the books, Gulliver's Travels, in the first spot. She will put another of the books, A