wigglechamber4 wigglechamber4

02-04-2020
Mathematics

contestada

Six men are aboard the International Space Station.

There are 1/3 as many as men aboard. How many

people in all are aboard the international Space Station?

Respuesta :

mnobile30 mnobile30

02-04-2020

There are officially two people aboard the space station
Answer: 2

Answer Link

Otras preguntas

given expression :4x-2y=11find the missing coordinate in ordered pair (-3,?)

Given the equation of the function, write the equation of the inverse, g(x). f(x) = 3x -1

I am confused and need this question quick It’s number 3

(1.5 x 10^-5) (3 x 10^2) express your answer in scientific notation

Hi i need help with unit rate fractions and ill show an example i need to have this figured out by thurday for a test and i have no clue so pls help

lily and jason each have 60 tokens . Each round lily add 5 of her tokens to the pot and jason add 3 of his tokens to the pot . the game continues either lily or

263747_+'('-+'++'+58"-

A segment of DNA is known to contain the following base sequence:3' GATACCTTTGTGTAGTCATCTT 5'a) Write the mRNA that would be transcribed from this DNA fragment.

A balloon is floating around outside your window. The temperature outside is 37 ∘C , and the air pressure is 0.800 atm . Your neighbor, who released the bal

How many protons, neutrons, and electrons are in an atom of beryllium with a mass number of 9? protons, electrons, neutrons protons, electrons, neutrons pr