yudithrangelmtz yudithrangelmtz

19-07-2017
Mathematics

contestada

A solid has all of the following charateristics, except for which? A. has a closed space B. is three-dimensional C. has an open space D. is measured in volume

Respuesta :

toddboylewfms toddboylewfms

19-07-2017

the correct answer is C because solids are 3D so they take up room and open space

Answer Link

Otras preguntas

The government might enact a price ceiling in order to accomplish what

What is the product of 3 2/3 × 5 1/4? A) 8 11/23B) 15 1/6C) 17 3/4D) 19 1/4PLZZZZZ HELP!!!

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

What is the measure of angle J in the triangle below? A. 99 B. 42 C. 9 D. 48

How does sissy feel when Mr.Gradgrind refers to her as “girl number twenty”? Confused and childish Embarrassed and anxious Proud to be one of the students Eage

Suppose someone gives you 15 to 4 odds that you can't roll 2 even numbers with the roll of 2 fair dice. This means you win $15 if you succeed and you lose $4 if

Please help I will reward brainly “ MUSIC”

Does the shape below show a correct line of symmetry? Explain

Which statement is true? All rectangles are parallelograms. All rectangles are squares. Some triangles are quadrilaterals. Every rhombus is a square.

Factor to find the zeros of the function defined by the quadratic expression. 9x2 − 63x − 702