paytoncoleman98 paytoncoleman98

03-06-2022
Health

contestada

Why is it important to include recovery time in a workout program?

Respuesta :

nuteron43 nuteron43

03-06-2022

Answer:

Recovery time is essential in order to maximize efficency in muscle growth.

Explanation:

Recovery helps improve blood circulation in muscles and allow them to be properly repaired after they are broken down in a workout

Answer Link

Otras preguntas

solve similar triangles (advanced)

hatchet what thematic topic is not evident in chapter 8?

It is a Saturday morning, and Jeremy has discovered he has a leak coming from the water heater in his attic. Since plumbers charge extra to come out on weekends

Is a marble cake the best way to describe the dynamic involved in cooperative federalism? If so, why? If not, what would be a better way to illustrate that rela

23. Find the next three terms of the arithmetic sequence. 19, 24, 29, 34, ...

The sum of 139 and the product of a number raised to the third power and 17. In symbols, the phrase is written as.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

manilla and linen are derived from which plants, respectively

A banana is 8 inches long how many 0. 4 inch slices.

how to find acceleration with mass and force calculator