linnkaay linnkaay
  • 19-07-2021
  • Social Studies
contestada

what does "form a more perfect union " mean

Respuesta :

tumadre33 tumadre33
  • 19-07-2021
to keep the country together as 1
Answer Link

Otras preguntas

Which of the following points lie in the solution set to the following system of inequalities? y > â’3x 3 y > x 2 (2, â’5) (â’2, 5) (2, 5) (â’2, â’5).
How did the religious lyrics of the thirteenth century carry on the theme of transience seen earlier in Anglo-Saxon poetry
Area of square whose side is 11 cm ________
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
testing with a urine reagent test strip shows that a patient’s urine is positive for protein, negative for glucose and blood, and has a ph of 8.2. what will the
need help with this problem
perfectly competitive market in long run equilibrium. if demand decreases, we can be certain that price will
What is the sum of the 4th square number and the 12th square number
Suppose the sample space for a probability experiment has 48 elements. If items from the sample space are selected without replacement, how many different ways
Which of the following is a criticism of piaget's cognitive development theory?.