jacobvibbart
jacobvibbart jacobvibbart
  • 17-12-2020
  • Mathematics
contestada

hello people does anyone

Respuesta :

charlotte361
charlotte361 charlotte361
  • 17-12-2020
does anyone what BEHKWNRHS
Answer Link
UnknownRRT
UnknownRRT UnknownRRT
  • 17-12-2020

Answer:

The answer is 24. Yes we do.

Answer Link

Otras preguntas

Elephants appear to have excellent __________ because they can remember large sections of their territory.
Factors affecting transpiration with celery experiment results
A mineral is defined as a natural substance that is neither animal nor plant, has a A. specific composition and structure, and contains one or more silicon-oxy
How much does it cost to fly a dog internationally
If a constant force acts upon an object with a mass of 2 kg, the acceleration of the object is 14 m/s^2. When the same Force acts upon another object it's accel
solve the equation 1 = u over 2
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
PLZ HELP! 50 POINTS!!!! Which device is used to change a signal into a code?Group of answer choicesan encoderan antennaa wave
reproduction is not necessary for the continuation of species
Find the slope of the line on the graph. Write your answer as a fraction or whole number, but a mixed number or decimal.
ACCESS MORE