alvonte022005
alvonte022005 alvonte022005
  • 17-11-2020
  • History
contestada

The Second Amendment gives the citizen the right to _____.

Respuesta :

lesliefrierson lesliefrierson
  • 17-11-2020

the right of the people to keep and bear Arms, shall not be infringed

Answer Link

Otras preguntas

How long does the earth take to complete its rotation brainly.
If 3x-2=11, what is the value of 6x+5? PLS HELP
Hanna has 88cm of ribbon and cuts it in the ratio 5 : 6. How much longer is the longest piece and the shortest piece?​
In which detail does the author provide a reason not to connect the negative end of a battery to the positive end directly? A "...the battery will lose energy q
How do you write 1.75 trillion, 1.75 quadrillion
If 3 people share 5 pizzas , how much pizza does each person get
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
the triangles are similar. what is the value of x? enter your answer in the box.
what makes the french and american revolutions have in common
the ratio of income of a family is 11:2. find the expanditure if the saving is 1520