19-10-2020
Social Studies

contestada

If we got the right to bear arms, why can’t we wear tank tops in school

Respuesta :

natalexria natalexria

19-10-2020

Answer:

To bear arms means to own a weapon

Explanation:

It means u have to follow the rules of the school

Answer Link

Otras preguntas

what is the hierarchical structural organization in a multicellular organism

Which of the following is an effect of global warming? a. Falling sea levels b. Decrease in the acidity of seawater c. Heavier rainfall and flooding d. Health i

W/5+20=22. How do I do this

20. If you want to generate ideas from your own experiences, what should you do? O A. Interview your friends and family to find out what they think about you. O

How is a narrative poem different from a short story? Its characters are more likely to change by the end. Its events suggest a theme. It is divided into stanza

When a team uses an interdisciplinary approach _____. all members are working toward a common goal each member is accountable for only his or her work all team

This is the question in the photo above.

1/5 of 400 showing work

how to find time with acceleration and velocity

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

ACCESS MORE