riveravalentina26 riveravalentina26

28-04-2020
Mathematics

contestada

The radius circle is 8. What is the circumference?

Respuesta :

jacobih7 jacobih7

28-04-2020

Answer:

50.27

Step-by-step explanation:

C=2πr=2·π·8≈50.26548

Answer Link

Otras preguntas

How are genes passed from parent to offspring?

A sailor is allowed 7 days off for every 30 days at sea. For 28 days off, how many days at sea must the sailor spend?

Otto and Olivia each have six markers. Otto is missing the purple and green markers, andOlivia is missing the black and brown markers. What can they do so that

A glass is 1 6 full. Then 95cm3 of orange juice is poured in. The glass is now 4 5 full. What is the total volume of the glass?

Khan Academy Factor using polynomial division The polynomial p(x) = x3 + 7x2 – 36 has a known factor of (x + 3). Rewrite p(x) as a product of linear factors. p(

If Toni is trying to calculate her net worth, which of the following items would go on the liabilities list? *A. Original sale price of her car B.Her Mortgage C

the coefficient of xy in 6x2y2 is

Huck and Buck have rhyming names. From what we know of Buck so far, what qualities do they have in common? How do they differ?

A party rental company has chairs and tables for rent. The total cost to rent 3 chairs and 2 tables is $25. The total cost to rent 8 chairs and 4 tables is $53.

Help I'm confused! This is the beginning sequence of the first exon in the mRNA sequence: AUGAAGCUCUUUUGGUUGCUUUUCACCAUU Give the DNA/genomic sequence it was tr