30-11-2020
Biology

contestada

Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:

AUGAAGCUCUUUUGGUUGCUUUUCACCAUU

Give the DNA/genomic sequence it was transcribed from.

Respuesta :

30-11-2020

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

Answer Link

Otras preguntas

Complete the following dialogue with the correct word below: "Tu veux regarder ce film chinois avec moi?" "Mais je ne parle pas chinois!" "Ce n'est rien, il y a

what you think will be the greatest obstacle for the United States moving away from fossil fuels and toward greater use of renewable energy.

Anorexia nervosa has been associated with a primary dysfunction of which structure of the brain?

Which best explains the high cost of Aslan goods

Jacinta says that the product of a rational number and an irrational number is always irrational. Explain her error.

What do the weapons and the soldiers in the cartoon represent? Hint: Look at the map from the previous lesson.

5x 2x 7x 4x Equation X=

Multiple Choice Choose the answer that best answers the question. Read the following sentence. The underlined phrase is an idiom that uses figurative language.

The line A bus arrives at the stop every 25 min. and the line B bus arrives every 15 min. Both arrive at the bus stop at 1 pm. At what time will both be at the

8 to the power of 8 = ?. (BOOT) To the power of three = 27 WHAT IS THE BOOTS VALUE? WILL GIVE FIVE STAR ANSWER!!!!!!!!!!!!!!!!!!

ACCESS MORE