marcianiesusavko5
marcianiesusavko5 marcianiesusavko5
  • 04-06-2016
  • English
contestada

Abram and Balthasar, who appear in Scene i, are examples of
a. flat characters.
c. typical servants.
b. round characters.
d. hot-headed young men.

Respuesta :

Hagrid
Hagrid Hagrid
  • 06-06-2016
The right answer for the question that is being asked and shown above is that: "d. hot-headed young men." Abram and Balthasar, who appear in Scene i, are examples of d. hot-headed young men. The roles they portray are being as hot-headed person.
Answer Link

Otras preguntas

A child riding a bicycle at 15 m/s accelerates at 3. 0 m/s/s for 4. 0 s. What is the child's speed at the end of this 4. 0 s interval?.
triangle abc has an area of 6 and a perimeter of 12. if the triangle is dilated by a scale factor of 3 centered at the origin, what is the area and perimeter of
Decide if the following sentence is grammatically CORRECT or INCORRECT. Pierre: Est-ce que tu veux venir au cinéma avec moi? Alice: Non merci, je ne veux pas en
There is 46% hard working Elfs in the North Pole. there is 300 elfs in north pole. How many elfs are hard working
200.000 rounded to the nearest tenth i'm 9 and still know this so if you don't you are not smart
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
where does the normal line to the ellipse x2−xy y2=3 at the point (−1,1) intersect the ellipse for the second time?
"Eukaryotes are more evolved than prokaryotes."Do you agree the statement?​
What type of cells do humans have prokaryotic or eukaryotic?
lf the exchange rate of 1 dollar is Rs 72.45. how many dollars exchanged for Rs 1449 ?​