JLeeLee9750 JLeeLee9750
  • 31-03-2018
  • Chemistry
contestada

When acids and bases react the product other than water is a?

Respuesta :

mcp2 mcp2
  • 31-03-2018
You are referring to Bronsted acids and bases right? which are different than Lewis acids and bases - just wanted to clear that up for future reference. The answer to your question is a salt. .
Answer Link

Otras preguntas

Kevin will take 4 math tests this term. All of the tests are worth the same number of points. After taking the first 3 tests, his mean test score is 88 points.
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
Write expression using the distributive property to find the product of 7 times 63
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
where are the three parts of an atom located
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
In which system of government would states function independently of each other?
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
define concentric circles