setonmom5267 setonmom5267

02-03-2018
Biology

contestada

Organisms whose cells do not contain a well-defined nucleus are called ______________.

Respuesta :

aalinnaa77 aalinnaa77

02-03-2018

i believe its prokaryotes

Answer Link

Otras preguntas

Which of the following is equal to sqrt(16 * 4) ?

Consider the following mRNA strand: CCAUGGCAAAGGAGUGACUAA a. What DNA sequence would encode for this mRNA? Provide the sequence in form (single-or doublestrand

Eukaryotic cells and prokaryotic cells both have ribosomes and a cell membrane. Is this true? I will mark brainliest

Chloroplasts convert energy from the house sun into ? The mitochondria use glucose to produce energy in the form of ?

Select all that apply. Which conditions relate to the research of van Helmont? conducted around 1400 A.D. demonstrated plant food from soil plant mass related t

Mark bought an electric tablet on sale for 1/4 off the original price of $825.00. He also wanted to use a coupon for 1/5 off the sales price. How much did Mark

The cost of 11 pounds of fertilizer is $33.77. What is the constant of proportionality that related the cost in dollars, y, to the number of pounds of fertilize

Which type of media can use both audio and visual elements? A. Magazines B. Televinjon C. Newspapers D. Radio

Any vibrating object can be a source of sound. A) true B)false

Develop and strengthen writing as needed by planning, revising, editing, rewriting, or trying a new approach, focusing on addressing what is most significant fo