R3bounds R3bounds

19-01-2018
Mathematics

contestada

what is -5a + 3b + 8a

Respuesta :

Аноним Аноним

19-01-2018

The equation can be simplified to 3a + 3b. Hope this helps :)

Answer Link

Otras preguntas

I said to you I completed your work yesterday change this into indirect speech

What are tools used by scientists to predict the weather?

Chaleah deposited $700 in a new account that earns 5 simple interest. After 4 years, how much interest will she have earned? How much total money will Chaleah h

Popular sovereignty refers to the __________. A. way the national government treats the states B. popular laws in the Constitution C. way popular people get el

Which of these groups of people would have been most likely to apply this idea to their feelings toward immigrants? Nativists who opposed anti-Semitism Settleme

¡Es el conductor del autobús! policeman driver fireman teacher

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

Choose the best Spanish equivalent to the phrase. Guillermo takes it. Guillermo me toma. Guillermo los toma. Guillermo la toma. Guillermo te toma.

Which statement best explains why women were needed as pilots during WWll?

How did scientists learn that climates howe Changes in the past?

ACCESS MORE