jaredcombs1318 jaredcombs1318
  • 18-01-2018
  • Advanced Placement (AP)
contestada

Generally, children under ___ and about one year of age should ride in a safety seat secured to the back seat, facing the rear of vehicle.

A.) 50 pounds
B.) 20 pounds
C.) 40 pounds
D.) 30 pounds

Respuesta :

samanthamunevar
samanthamunevar samanthamunevar
  • 18-01-2018
20 pounds hope that helps
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
1 pts. what is one difference between primary and secondary succession? a. primary succession is rapid and secondary succession is slow. b. secondary succession
How and where (at what latitudes) do atmospheric convection cells form?
Find the number. Six times a number is 9 more than three times the number. The number is |___| What I’m thinking right now “6x=27”
Can you help me to find this answer, please, I need help
Help with these 4 questions please and thanks!!! 1. Find the radius of the circle x2 + 8x - 4 + y2 + 2y = 12 A. 9 B. 3 C. 5 D. 25 2. Find the center and radius
if f(x)=4x-6, what is f(6)
Why is it important for scientists to use blind tests?
7. A company's marginal revenue is $10, its marginal cost is $10, and its price is $10. This company is operating in a/an _______ market structure. A
what does the constitution state about the interaction of the judicial branch and new laws