jjjxxcsenone4170 jjjxxcsenone4170
  • 01-01-2018
  • Social Studies
contestada

Five-year-old benjy has an iq of 120 on the original version of the stanford-binet. his mental age is

Respuesta :

itsveedikulus
itsveedikulus itsveedikulus
  • 01-01-2018
The correct answer is; 6. His mental age is six.

Hope this helped and Happy New Year! :)
Answer Link

Otras preguntas

Which sentence has two antecedents and one pronoun? Laurie likes to bake in her new oven. Cody and Aleena sold their car. My school does not have an October
How do you put allele in a sentence
In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
the table shows the elevation of 6 cities in CaliforniaCity                                                               ElevationWestmorland
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Did feudalism create a stable form of government?
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
The section of the small intestine between the duodenum and ilium?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What were the driving forces behind the industrial revolution