cassiana4u cassiana4u

18-12-2017
Mathematics

contestada

is fgh congruent to jkl if so identify the similarity postulate or theorem that applies

Respuesta :

timoteo timoteo

18-12-2017

you're supposed to put the picture with the question.

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

How are species endangered by human activity? Human activity causes flooding that ruin the species' food sources. Human activity creates earthquakes that destro

10 x (12+5) is equal to what expression

how was captain von trapp as a parent before maria's influence, another question about the sound of music

A box is being pushed by two stellar science students , one on each side of the box . Chidera is pushing the box with a force of 30 N to the left . Jonathan is

A forest fire in California destroys almost fifty acres of Forest. For scientists working in the forest in the years after the fire, which will they be observin

Lauren and Aidan left their offices at 6:15 p.m. and drove to meet at a restaurant the same distance away from their offices for dinner. Lauren drove at a const

What is the value of the expression - 4(5 – 9)?

Please help me understand!!

Which equation illustrates the commutative property? O A. f +5= f + 5 O B. m (2 – n) = m (n m − 2) O C. P +q=a+p O D. (h + 5) – 3 = h + (5 – 3)