marieblossom16 marieblossom16

26-10-2015
Mathematics

contestada

I just need to find y explain please :p

I just need to find y explain please p class=

Respuesta :

albertoe97 albertoe97

26-10-2015

rewrite in slope intercept from y=mx+b y=1-3x+11/3

Answer Link

Аноним Аноним

10-02-2021

Answer:

y=mx+b y=1-3x+11/3

Step-by-step explanation:

Answer Link

Otras preguntas

1) Abby started making oatmeal cookies at 11:30 A.M. It took her 30 minutes to make the dough and 1 hour and 30 minutes to bake all of the cookies. What time wa

Dracula's mortgage payment was $1,250 is automatically deducted from his paycheck each month. His company has decided to pay his mortgage as a bonus for the nex

What is one example of the way a rise in productivity during the 1950s improved the standard of living in the United States? A) it gave workers more time off. B

This glandular tissue resembles that of the salivary gland (clusters of zymogenic cells). What feature unique to the pancreas would help you to distinguish it f

I FAILED! Find the correct result. 1+4=5 2+5=12 3+6=21 5+8=_________ If your answer is wrong, you must upload it on your timeline. GAME? If your answer is wrong

A review of Parson Corporation's accounting records found that at a volume of 144,000 units, the variable and fixed cost per unit amounted to $6 and $2, respect

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

Assume that The Bell Company operates in an industry for which NOL carryback is allowed. The Bell Company had the following operating results: Year Income (loss

-80%+54/50-.25= What does this equation equal to answer correctly pls 5 star and hearts/ brainiest role for however answers first.

negative five divided by 5/7

ACCESS MORE