JEThompson825 JEThompson825

02-11-2017
Social Studies

contestada

What is the dominant factor that determines where people live in southwest asia and north africa?

Respuesta :

Jabber98 Jabber98

02-11-2017

The Mediterranean Sea. If the land is directly south of the Mediterranean, it’s Africa. If the land is directly east its southwestern Asia. If the land is north of the Mediterranean it’s Europe.

Answer Link

Otras preguntas

What did president wilson's wife make sure was on the white house lawn?

What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o

Through what system is glucose delievered to cells for cellular respiration

Need help on this geometry please someone ?

If aspartame is successfully hydrolyzed, the products are methanol, phenylalanine and aspartic acid. what two functional groups must be hydrolyzed for this reac

The length of a rectangle is three times its width. If the perimeter of the rectangle is 40ft find it’s area

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

When did Christianity become the official religion for the Roman Empire

PLEASE!!!!!!!!!! HELP NEEDED QUICKA state offers two lottery games, WinOne and PlayBall. Both games cost $2 per ticket. -In WinOne, the player picks a single

Use factoring to simplify the expression x^2-x-6/x-3 assume that x does not equal 3