Jasonfuny1423 Jasonfuny1423

27-10-2017
History

contestada

how did farmers in early civilizations benefit from controlling the flooding of rivers

Respuesta :

tattoosbybrittowyhod tattoosbybrittowyhod

27-10-2017

by using the water for agriculture or farming/herding

Answer Link

Otras preguntas

The sequence of nucleotides in an mRNA is 5’AUGACCCAUUGGUCUCGUUGGCUGAAGUCA 3’. Hydroxylamine is a mutagen that results in the conversion of a GC base pair in t

what two number multiplies to -24 and add up to 10

Tracy Company, a manufacturer of air conditioners, sold 100 units to Thomas Company on November 17, 2016. The units have a list price of $500 each, but Thomas w

What question is Maya most likely trying to answer?

(fill in the blank) prairies and savanna's are two type of ____

what is the surface area of a cylinder with base radius 4 and height 5

Please help me on this moby max question

Longordia Foods is expecting to generate after-tax income of $1,558,888, $2,933,312, and $3,261,712 for each of the next three years. The equipment used will ha

Piper Corporation’s standards call for 3,900 direct labor-hours to produce 1,300 units of product. During October the company worked 1,200 direct labor-hours an

High-strength concrete is supposed to have a compressive strength greater than 6,000 pounds per square inch (psi). A certain type of concrete has a mean compres