kristintay221 kristintay221
  • 27-08-2015
  • Mathematics
contestada

11 decreased by twice a number is 15 what is the number

Respuesta :

EdwinWang
EdwinWang EdwinWang
  • 27-08-2015
11-2x=15
    -2x=4
     2x=-4
      x=-2
Answer Link

Otras preguntas

(3x+5)-(x+2) i need to figure out what it equals
Your welcome to stay with us whenever you want.
How can molecules with polar bonds be non-polar?
Name the 3 main Anglo-Saxon earldoms
The diameter of the planet mars is approximately 6.794 × 10^6 meters. Which is an equivalent way to express that measure? a- 6.794 billion meters b- 679.4 milli
Read this excerpt from "Wiley, His Mama, and the Hairy Man” in The People Could Fly The Hairy Man . . . hollered loud. "From now on, all the rope in this county
what is the mrna of tacgggcctatacgctactactggatc​
find the area of rectangle 7 cm long 3 cm wide give a unit of measurement
Why is there a difference between interest charged and interest earned? A)Banks are non-profit institutions.B)Banks are profit-making institutions.C)Banks must
who wrote the National Anthem for the U.S.A​