eveineedshelpinmath eveineedshelpinmath

17-09-2017
Mathematics

contestada

2 pairs of numbers whose Least common multiple is the product

Respuesta :

ndrsn112803 ndrsn112803

27-09-2017

I'm not sure what you're really asking but 6 and 9's LCM is 18

Answer Link

Otras preguntas

What does the lambic system do? A. registers feelings, such as fear and pleasure B. directs incoming sensory messages C. coordinates involuntary muscle movemen

Dante has a vegetable garden. He places several earthworms in the garden’s soil. Which statement explains the most likely reason Dante puts worms in his garde

The learning curve describes the ________ relationship between ________ and ________

Now that you have worked through a lot of material that includes these basic patterns, and you have compared grammatically correct and incorrect sentences, writ

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

if the volume of a triangular prism is 120 base l is is 6 and base h is is 5 what is the height

What does Thomas Jefferson mean by Certain unalienable rights and the in the excerpt from the Declaration of Independence

2. You must use headlights when driving ___________________. A. between sunset and sunrise B. in rain C. half hour after sunset and half hour before sunrise D.

There are only three types of polygons that can be the faces of a Platonic solid. They are _____, _____, and _____. Check all that apply. A. rectangles B. squar

an equilateral triangle has perimeter 18 inches. what would be the perimeter of a square whose sides each measure the same length as the side of the triangle?

ACCESS MORE