arwaalghazali65 arwaalghazali65

30-03-2024
Social Studies

contestada

A courteous and a considerable person to other people is called : ……………….
1 )Ethics
2)Respect
3)Communication
4)Honesty
5)Attitude

Respuesta :

harajukunails harajukunails

30-03-2024

A courteous and a considerable person to another person is called respect

Answer Link

Otras preguntas

When choosing a healthcare provider, who is responsible for making sure insurance covers the care? A. you B. doctors C. insurance companies D. nurses

Stereotype threat is more likely to affect those who are high achievers because high achievers are __________ than low achievers

Geoffery went on a trip across South America. He took 1,750 US dollars (USD) with him. In Chile, he traded his money for Chilean pesos (CLP) at a rate of USD:CL

Which terrorist group means "students of Islamic knowledge"? Taliban Al Qaeda Maktab al-Khidimat

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

How does Anne use language to help readers understand her thoughts on nature? Question 8 options: a) Anne uses the same language when writing about nature that

How do plants dissolve rock

What did Freedom Summer try to accomplish?

The software program you need to have to read PDF file, such as the PDF files you download from your My Courses page, is a. Applet. b. Shock Wave. c. Flash.

Which theory suggests that the moon and the earth formed at the same time from dust and the solar nebula that formed the sun? A.) impact theory B.)co formation

ACCESS MORE EDU ACCESS Universidad de Mexico