adrianabrwn09 adrianabrwn09
  • 17-05-2017
  • Mathematics
contestada

can somebody help me with this problem

can somebody help me with this problem class=

Respuesta :

Аноним Аноним
  • 17-05-2017
10 checks is the answer
Answer Link
Аноним Аноним
  • 17-05-2017
Okay, hi! First what you need to do is read the problem! Second you need to breathe! Third you need to read the problem again! Last but not least you solve it!
Answer Link

Otras preguntas

Henry is buying school supplies for the start of the school year.For every 3 pencils he buys 2 pens.If Henry buys 21 pencils ,how many total pencils and pens di
Read the following scenario. A local political party is preparing to organize voters for an upcoming state election. Party members need to consider the best way
Who was a major influence of Martin Luther kings non violent approach to protest
Answer this.. Two advantages that a market economy has over a command economy are ____. A// more limits on profits and more public goods B// more freedom and mo
What countries make up the United Kingdom?
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for theme template strand above. What would the mRNA be based upon the template strand above?
-4-2n+4n>7-2^2 answer you wont before hour
Is it true that some people just need to experience the negative impacts of their decisions despite being shown the consequences by those who have already exper
IF YOU LIKE CHALLENGES, THIS IS FOR YOU!
why are the forms political communication harmful