quintondavis15 quintondavis15
  • 20-04-2017
  • History
contestada

Where does most of the federal government's money come from?

Respuesta :

xiamere12
xiamere12 xiamere12
  • 20-04-2017
Almost half of all federalrevenue (47 percent) comes from individual income taxes.
Answer Link
prettycool178
prettycool178 prettycool178
  • 20-04-2017
The three main sources of federal tax revenue are individual income taxes, payroll taxes, and corporate income taxes; other sources of tax revenue include excise taxes.
Answer Link

Otras preguntas

Somebody please help me
How was General Gillespie killed?​
Is it point s,w,v, or R PLEase HELP
PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU
Given g(x)=3x+6, find the value of x when g(x)=30.
What is "Motion?" Any physical movement or change of position of an object When an object is square When An object is standing still
6. The complex is formed when the DNA double helix coils around the proteins A. nucleosome; histone B. chromosome; ribosome C. histone; ribosome D. chromosome;
Can someone help me on this?
how do baby acorns know when its time to leave their acorn homes ​
C)Determination leads to success.dSome people are inferior by birth.e)A good person is never helpful and kind.Hard work and patience help us to get success.We c