KassadyU714222 KassadyU714222

31-10-2022
Mathematics

contestada

If I have:48x"y2-247*y+12'y12yWhat is the first term of my quotlent?O 36cyO 36x²yO 4x²yO 403

Respuesta :

JaidynnX100748 JaidynnX100748

31-10-2022

Therefore, the first quotient is

[tex]4x^2y[/tex]

Ver imagen JaidynnX100748

Answer Link

Otras preguntas

Find the value of x that will make A||B 9x + 4 5x + 20 x = [?]

how does ATP enter the body during cellular respiration

Find the value of 7+c when c=18.

what is the area of the rectangle that is 3/2 tall and 6/2 long explain how you got your answer.

Where did the hieroglyphics on Queen Nefertari's tomb wall painting come from? Pyramid Texts The Book of the Dead Papyrus of Ani The Book of Amduat

2+3+4+5+7+7+9+6+7+8+7+8+9+8+0+7+7+7+7+7

Sometimes multiple genes for the same trait can be expressed, causing a "mixing" of the phenotypes. This is known as?

Which statement best describes illegal immigration to the United States today?

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

f(x) = 6x + 2 find f(4)