s651278 s651278

28-06-2022
Mathematics

contestada

(49p2–490p) ÷(p–10)

please help!!

Respuesta :

s649568 s649568

28-06-2022

Answer:

(49p2–490p) ÷(p–10)

Step-by-step explanation:

Answer Link

Otras preguntas

how long after wisdom teeth removal can i use a straw

he probability symbol (~) represents the probability of an event happening. True False

What was so special about the buddha of ramyan statues and what made them such an enormous attraction to tourists?

Colette made a scale drawing of the elementary school. The scale of the drawing was 1 millimeter : 5 meters. The schoolyard is 34 millimeters long in the drawin

GO= 10x - 4 EO = 3x + 8 E is the midpoint of G0. Solve for x and find the length of each segment.

Which interpretation about the author Ch’i-Hal is supported by this source

(Look at picture) ty btw :)!!!!! <3

Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

prefix with circle to mean half a circle crossword

measurement of height and weight falls under what method of nutrition assessment?