contrerasedwin833
contrerasedwin833 contrerasedwin833
  • 03-05-2022
  • Mathematics
contestada

Prove that ABCD is not a parallelogram.

Prove that ABCD is not a parallelogram class=

Respuesta :

brujiczoe brujiczoe
  • 03-05-2022

Answer:

Segment AD is 4 units long, while segment BC is 5 units long. If this figure was a parallelogram, these two segments would be equal to each other.

Step-by-step explanation:

Answer Link

Otras preguntas

Danielle bought a dress that was on sale at the clothing store. After taking 40% off the original price of the dress, Danielle paid $39.15, not including tax. W
what is the mrna of tacgggcctatacgctactactggatc​
What is the measure of ∠MNO?
Gia went to the movies with her 7-year old daughter and her 70-year-old mother. Movie tickets are half-priced for children under 12 years old, and there is a 25
6x^2-66x+144=0 solving quadratic equation
(3x+5)-(x+2) i need to figure out what it equals
Which set of ordered pairs represents a function?
How did world war 2 impact the American economy? Did the war have the same impact on the British economy
What is the fourth term of the sequence a1=m an= 2an-1
finding the missing numbers. show the work. 26-4=12+ ?​