happychickenuwu277 happychickenuwu277

19-04-2022
Mathematics

contestada

41 divided by 4592 ??

Respuesta :

19-04-2022

Answer:

0.00892857....

Step-by-step explanation:

Convert the fraction to a decimal by dividing the numerator by the denominator.

Answer Link

Otras preguntas

What tissue type is the most abundant form of tissue, the most varied type of tissue, and provides support and mechanical protection? A) Epithelial tissue B) Co

CTGTTACTTTCAATCGTACACCAACACTGCTTTC Translate and transcribe this strand of DNA into mRNA and amino acids.

Francesca is working on her early childhood education degree. As a part of her degree requirements, Francesca will observe a first-grade classroom for three dif

What is the reflection of ( 6, 0 ) across the y-axis?

Paid channels provide a great deal of control and work quickly. They are an essential part of content marketing strategy.a) Trueb) False

PLEASE HELP! Sorry if you can't see it all the way it says: Two athletes are training for a cycling race. Each athlete recorded distance (in miles) of their pre

A man whose parents were normal with respect for color vision marries a woman of normal vision and similar pedigree. One of their daughters is colorblind. Give

Why is it important for someone accused of a crime to be considered innocent until proven guilty?

Which of the following metals is not classified as a major toxic metal with multiple effects? A) Arsenic B) Beryllium C) Chromium D) Mercury E) Silver

True or False: Peer-to-Peer networks are also commonly used for illicit activities such as illegally sharing copyrighted content like movies, music, software or

ACCESS MORE EDU ACCESS