amk1127z amk1127z

21-12-2021
Mathematics

contestada

If f(x) = 14
then what does f(-3) equal?

Respuesta :

engelkil000 engelkil000

21-12-2021

Answer:

27 I do believe so sorry if im wrong

Step-by-step explanation:

Answer Link

Otras preguntas

how can we maintain empathy and cooperation in the society

If you were writing an advertisement for a brand new product, would you call it "newfangled" or "cutting-edge" to attract potential buyers? Choose one of these

Please answer correctly !!!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!!!

Charles darwin suggested that atolls begin as coral reefs around volcanic islands. Will Surtsey island-icelands newest volcanic island ever become an atoll. Why

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Help please!! This is timed. I’ll give brainliest also!

Why did Ayub khan come to power in 1958?

Emily can bake 5 Christmas cupcakes in 3.5 hours. How many cupcakes can she bake in 7 hours?

(urgent! for dance!) Make a list of 5 qualities you believe an effective dance teacher must have. Why do you you think these 5 qualities are so important?

True or False? Resistance is the slowing of the flow of electrons and where some of the electrical energy is converted into heat. True False

ACCESS MORE EDU ACCESS