mom1655 mom1655

17-12-2021
Mathematics

contestada

Which table represents the same proportional relationship as the equation Y= 36x?

Which table represents the same proportional relationship as the equation Y 36x class=

Respuesta :

ellasteinbecker17 ellasteinbecker17

17-12-2021

Answer:

C

Step-by-step explanation:

It does what the equation says. It multiplies x by 36

I hope this helps!

Answer Link

Otras preguntas

Which of the points listed is the same distance from the y-axis as the point (−4, 7.5)?

Is 92 1/2 pounds equivalent to 1,480 ounces

1. What problems did the student’s experience?

explain why the feudal system was successful. Include details from the lesson and the reading to support your claims.

Use the drop-down menus to complete each sentence. was an economist who led a new school of classical economics. The concept of laissez faire refers to governme

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

According to Conservatives, the role of government in American life should be

Please help ill give brainliest. Carbon dioxide is released into the atmosphere by _____. photosynthesis fixation denitrification respiration

The french and indian war began when a. french leader jean valjean led an attack on fort ticonderoga. b. iroquois leader tanacharison ceded portions of western

There are 68 people employed by Food Giant in the Chang’s village. New workers receive $9.50 per hour while experienced workers receive $14.00 per hour. The co

ACCESS MORE