megazblastoise megazblastoise

16-12-2021
Mathematics

contestada

to divide 19.5 divided by 0.31 start by moving the decimal

Respuesta :

trainmanzach trainmanzach

16-12-2021

Answer:

it might be 6.045 im not that sure about this

Step-by-step explanation:

Answer Link

Otras preguntas

What effect does the author's varied syntax have on the narrator's voice and style? A. It helps create a formal, melancholy voice. B. It helps shape the voice

Would greatly appreciate if any of you can answer the question in the attached image with full explanation including a strategy for solving it. Thanks in advanc

trigger happy, pack heat, but it's black ink evil half of the bad meets evil that means take a back seat

Mr.green is putting lights around 8 windows each window is 3 and 1/2 feet wide and 5 feet long how many feet of lights does he need

which condition causes an individual to have dyspnea, wheezing, fluid retention, weakness, and possible arrhythmias?

The following information was available for Waterway Company at December 31, 2018: beginning inventory $107000; ending inventory $61000; cost of goods sold $613

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

an enslaved africanamerican's attempt to win freedom produces a controversial supreme court decision

compare and contrast the ways the american and french revolutions were influenced by the englighenment essay

According to research by Nisbett and Wilson (1977), which of the following is true of people when they are asked why they made a certain choice? - They can accu

ACCESS MORE