lu2cas1sajaklakirby lu2cas1sajaklakirby

04-01-2017
Chemistry

contestada

Identify the phrases that generally apply to molecular compounds a contain metals and nonmetals

Respuesta :

JoeCarter JoeCarter

04-01-2017

Ionic compounds/bonds are between metals and non metals

Answer Link

Аноним Аноним

05-01-2017

often are gases or liquids
have low melting points
use covalent bonding

Answer Link

Otras preguntas

Solve all the solutions of sinsquarex - cossquarex = 0 in the interval 0,2pi

It is illegal for a minor to even attempt to purchase alcohol. a. True b. False

A major difference between major depressive disorder and bipolar disorder is that only in bipolar disorder do people have _____. a. hallucinations or delusions

Both Ghandhi and king set which type of mood in their introduction

The drawing shows the measurements in a section of a circular design how long is the radius of the circle? F. 4.3 G. 7 H. 8.7 J. 10

what is the sum of odd positive integers less than 50

N the world's lowest-income nations, two in ten children born die by the age of

If 100 kg of cucumbers are 99% water, how much do they weigh if they are 97% water?

Sam is eating a Big Hamburger. The first bite was 20% of the Hamburger, the second bite was 20% of what is left and so every next bite is 20% of what is left. a

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat