adelarivera122006 adelarivera122006

29-10-2021
Mathematics

contestada

Plz help me plzzzz I need it plzzz

Plz help me plzzzz I need it plzzz class=

Respuesta :

iancpratt811 iancpratt811

29-10-2021

Answer:

Step-by-step explanation:

vertex: 0,-6

Axis of Symmetry(AOS): x=0

Domain: inf. < x < inf.

Range: -6 [tex]\leq[/tex] y < inf.

Transformation: y= x^2 - 6

Answer Link

Otras preguntas

Which of the following sentences is a declarative sentence? What will they think of next? We live in an amazing time. I simply adore cheese! Please tidy your r

The great scandal of the Nixon presidency was: a.) the bombing of Cambodia b.) an unstable economy c.) the scandal of Spiro Agnew d.) Watergate

ASAP — What specific (please name) metamorphic rocks come from out of the earth?

Appolla 11 had how many astronauts

Perimeter of a triangle

Hexagon DEFGHI is translated on the coordinate plane below to create hexagon D'E'F'G'H'I': Hexagon DEFGHI and Hexagon D prime E prime F prime G prime H prime I

how many minutes are there in 9 hours

And so I have the throne, all royal power Creon relies on __________ to make his argument. logos pathos harmatia ethos

Which part of a film camera focuses incoming light rays? A. diaphragm B. lens C. shutter D. viewfinder

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT