lolipopgumdrops1 lolipopgumdrops1

28-10-2021
Biology

contestada

Attraction between two or more ions is called a_

Respuesta :

BrainCube BrainCube

28-10-2021

Answer:

Attraction between two or more ions is called an ionic bond. A chemical bond is formed between two atoms by the complete transfer of one or more electrons from one atom to the other

Answer Link

Otras preguntas

193 + y is greater than or equal to 201

Len tosses a coin three times. The coin shows heads every time. What are the chances the coin shows tails on the next toss? Explain.

how did the aryans intertarct with the indus valley people

I am finding a topic sentence about the book thief that involves trust.I am currently in writers block.

Vitamins A, vitamin C, calcium and _________ are required to appear on nutritional labels. a. IRON b. ZINC c. POTASSIUM d. PHOSPHORUS

What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT

What happens if everyone in the world jumped at once ?

Up until the twentieth century, the Atlantic slave trade marked the largest intercontinental migration of people in history. a. True b. False

how many tons are in 40000 pounds

evaluate the impact/effects of fraud and corruption on a company

ACCESS MORE EDU ACCESS