manasangreddy7183 manasangreddy7183
  • 29-09-2021
  • Biology
contestada

which shot angle rarely results in a clean kill, ruins a lot of meat, and provides an animal the best opportunity to detect the hunter?

Respuesta :

brooklynnplathrop
brooklynnplathrop brooklynnplathrop
  • 29-09-2021

Answer:

Head-on-shot angle

Explanation:

The animal will certainly detect your movements with a head-on shot angle. Firearm:

A head-on shot can be effective if you have an adequate firearm and your firearm is already positioned for the shot.

However, head-on shots rarely result in a clean kill and ruin a lot of meat.

Answer Link

Otras preguntas

Hemophilia is a recessive sex linked trait. A male hemophiliac and a phenotypically normal female have a girl that is hemophiliac. Which of the following statem
which of the following particles is the fundamental unit of all matter, both living and nonliving ? a)neuron b)electron c)atom d)cell
how to grow plants in space?​
I need help with 5. And 6. Plsss!!
What is Pasifika Art?
evaluate the expression 2x/y for x= -28 and y =-7
Plz help me!!!!!!!!!!!!
HELP QUICKLY The graph shows the total number of hours Katrina worked over a 10-day period.
what is the mrna of tacgggcctatacgctactactggatc​
A rectangle has a length this is three times its width. If the area of the rectangle is 27 square feet, what are the dimensions of the rectangle