skyko9321 skyko9321
  • 02-09-2021
  • Mathematics
contestada

as the age of cars increases , its value decreases which correlation best represents this relationship ?

Respuesta :

xsychic
xsychic xsychic
  • 02-09-2021

hi <3

this type of correlation is called a negative correlation

hope this helps :)

Answer Link

Otras preguntas

The lengths of pregnancies are normally distributed with a mean of 208 days and a standard deviation of 15 days. A wife claimed to have given birth 308 days aft
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
Antonina needs to have worked at least 90 volunteer hours to graduate. She has already volunteered with a housing organization over the summer for 52 hours. Ant
Which of the following severely hampers food distribution in Equatorial Africa?
Someone tell me answer!!!
A titanium cube contains 3.10•10^23 atoms. The density of a titanium is 4.50g/cm^3. What is the edge length of the cube? PLEASE HELPPP! :(
Write an equation of a line that passes through the following two points: (4,-6) and (2,8).
the number of terms in AP-11,-8,-5......is
The Alvin Secretarial Service procures temporary office personnel for major corporations. They have found that 60% of their invoices are paid within ten working
Whenever the Parliament clashed with their monarch, the king would get his way by suddenly convening Parliament in a remote, unreachable part of the country. W