oso3re oso3re
  • 17-06-2021
  • Mathematics
contestada

What is the explicit formula for this geometric sequence?
27,9,3,1,...
O A. &, = 3.(27)(n-1
)
O B. , = 27.(1) "
OC.
2. - *•(27)(n-1
)
O D.
an
= 27.3(n-1)

Respuesta :

upretiaruna23
upretiaruna23 upretiaruna23
  • 23-06-2021

Answer:

The explicit formula for this geometric sequence is 27.3(n-1)

Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
If 100 people drink 1.5 cups of coffee a day and the cost per cup is .40 how much would it cost to provide coffee for the whole year if you're place is open 5 d
help please i’ll give brainliest
Please factor b^2+36=0
Is Hibernating a structure or a function
I'm only a few streets away. I'll be there in two seconds! * What type of figurative language is that? a. hyprebole b. personification c. metaphor d. idiom
Find the value of x.
True or False In sexual reproduction, two diploid cells can fuse to form a haploid cell
Name the following compound: CH3 I CH = CH2 - CH3 I CH2 I CH - CH3 I CH2 I CH I CH3 2-ethyl-4-methylheptane 2-ethyl-4-methylheptene 3-m
Complete the square. Fill in the number that makes the polynomial a perfect-square quadratic.k² − 4k + ​