velascoyarix16 velascoyarix16
  • 04-06-2021
  • English
contestada

que enunciado es una inferencia sobre la odisea

Respuesta :

anisarimy05
anisarimy05 anisarimy05
  • 04-06-2021

Answer:

El rey Alcinous probablemente estaba agradecido de que Ulises derrotara al cíclope.

Explanation:

Answer Link

Otras preguntas

what is the speed of a vehicle that moves 40 meters in 2 seconds
5’ATGCCCGGGTGTCGTAGTTGA3’ Complete the complementary sequence for the template strand.
Which meal of the day is largest in many Spanish-speaking countries what is the Spanish word for this meal during which hours of the day does it take place
What supplies did the Sumerians have?
what is the number of cells in a tapeworm?
Compare 9 × (11 – 4) and 3 × (11 – 4). A. 9 × (11 – 4) is three times as much as 3 × (11 – 4). B. 9 × (11 – 4) is nine times as much as 3 × (11 – 4)
“ stretch your thinking “ help answer
I need help on the last question
What was the name of the Jewish nationalist movement
Aaron has two boards that are 1.36 CM each in length if he puts them together how long will the board stretch
ACCESS MORE