jessica11esp0 jessica11esp0
  • 04-05-2021
  • Mathematics
contestada

Help meeeee lleaseeeee :))

Help meeeee lleaseeeee class=

Respuesta :

25camronheardboyd
25camronheardboyd 25camronheardboyd
  • 04-05-2021

Answer:

a

Step-by-step explanation:

Answer Link
jayani81
jayani81 jayani81
  • 05-05-2021
The answer will be the first option. Hope this helps
Answer Link

Otras preguntas

what is the mrna of tacgggcctatacgctactactggatc​
Many factories in northern Italy use______ for energy. - hydroelectricity - coal - nuclear energy- natural gas ​
What is the highest point on a wave called
Later 7 students joined group 2 (41 students)and one student left to join group 1. (44 students) Now 20 students play trombone and 7 more students play trumpet
What 3 questions do toxicologist want to answer
What river carries almost half of Russia’s river traffic?
what what has been the impact of the universal Declaration of Human Rights a, it has been used worldwide as a statement of basic freedoms every person is entitl
a. I, III, II b. II, I, III c. II, III, I d. III, I, II
Help me accidentally checked it in !!!!!!!!!
Why are dashes rather than parentheses or commas used in this sentence
ACCESS MORE