pariso82 pariso82
  • 03-05-2021
  • Biology
contestada

Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
T-A-C-G-T-C-A-G-T-G-G|
2. You just wrote in the template strand of DNA. Use the template strand to transcribe a strand
of mRNA
mRNA

Respuesta :

clarareina04 clarareina04
  • 03-05-2021

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

Answer Link

Otras preguntas

What does Strong, willing sinews in your wings mean ? In the poem to America by James Weldon
is georgia located in the southern region of the us
Charles is planning on driving his car to the family reunion. The distance to the meeting place is 1356 miles. If his car gets 30 mpg, how many gallons of gas w
What are the two types of minerals?
a solution must be at a higher temperature than a pure solvent to boil. what colligative property can be employed to achieve this?
find the value of 1.2 to the 2nd power
The map of a walking trail is drawn on a coordinate grid with three points of interest. The trail starts at R(−1, 4) and goes to S(5, 4) and continues to T(5, −
Which item does not belong in the grouping? a) Eisenhower Doctrine b) Bay of Pigs c) Camp David Accords d) OPEC/Oil Embargo
Most present-day Israelis originally came from _____.
What do organisms need in the space where they live?
ACCESS MORE