tortuga111 tortuga111

01-05-2021
Spanish

contestada

How to say "Happy 19th anniversary" in Spanish.

Respuesta :

zarampa zarampa

28-05-2021

Answer:

Explanation:

Feliz diecinueveavo aniversario.

Answer Link

Otras preguntas

simplify 13 + 54 divided by 9 plz help :

A bag contains exactly three red marbles, five yellow marbles and two blue marbles. If three marbles are drawn from the bag without replacement, what is the pro

using the ideal gas law, PV=nRT, where R=0.0821 L atm/mol K, calculate the volume in liters of oxygen produced by the catalytic decomposition of 25.5 g potassiu

please answer fast

Who else ships Naruto x Sasuke? I def doooooo <3 and yes this is school related its a school social assignment

Which of the following functions represent exponential decay?

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

A board 120 inches long is divided into 2 sections if the ratio of the 2 sections is 3 : 5 what are the lengths of the sections

If a gig economy driver takes the standard mileage rate (SMR), which additional expense is allowed on top of the SMR?

Which of these is a Microsoft certification for system engineers