aaguil717 aaguil717
  • 29-03-2021
  • Mathematics
contestada

Use the explicit formula to find the 7th term of the Geometric sequence.

A(1) = 5 r = 4

Respuesta :

cxt
cxt cxt
  • 29-03-2021

Answer:

a

Step-by-step explanation:

a

Answer Link

Otras preguntas

What voltage is needed to cause a 5A current flow through a 2Ω resistor?
Does your body lose or gain thermal energy is your body temperature is 37 C and the temperature around you is 25 C
List the names of the people that hold the following positions of government. Local : Sheriff Clerk of Court Mayor Local Councilman State : Governor Secretary o
Use the drop-down menus to complete the sentences. The rulers of the (blank) empire in southern India spoke Tamil. Indian cultural ideas and practices spread f
What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
How did George Washington set an example for all succeeding presidents?
Witch country should I perfer to live in for its climate,natural resources,location and trade Germany or Italy
Animal cells do not have a ____ or ____, but plant cells do
Factor completely. x^6 − 27
Nora tied a string around a tennis ball, and then she swung it in a circle in front of her to demonstrate a planet orbiting the Sun. She explained that her hand