18-11-2016
Biology

contestada

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT
TACGCGACGTGCACGTGCAA MRNA-----

Respuesta :

18-11-2016

I believe A translates to U, T transtates to A, G translates to C, and C traslates to G.

ATGCGCTGCACGTGCACGTTTACGCGACGTGCACGTGCAA

mRNA

UACGCGACGUGCACGUGCAAAUGCGCUGCACGUGCACGUU

Answer Link

Otras preguntas

Please help this assignment is due in few hours and I am stuck on this question Find an equation for the graph sketched below:

. A potential difference of 12 V across a resistor produces a current of 16 mA. (a) What is the value of the resistor? (b) Assuming the resistor is ohmic, find

How can you use multiplication to check your division

George owned some land that was taken by the state for building a new highway. George filed a suit. The state's action is of taking his property could be a viol

If I made a solution with 50g KI and 25g I2 dissolved in 500ml H2O and I used a 100ml of the 500ml solution, what is the molarity of the 100ml?

Light with a wavelength of 550 nm is traveling through a 50 kg block of ice (n=1.3). How fast is the light traveling in m/s?

What is the volume of this prism? All angles are right angles. 4 yd. 18 yd. Submit 14 yd. 6 yd.. cubic yards 4 yd. 10 yd. 7 yd.

George owned some land that was taken by the state for building a new highway. George filed a suit. The state's action is of taking his property could be a viol

If Julian walks from his house to his school at a speed of 3 miles per hour he will be five minutes late for class. If he cycles to school at a speed of 10 mile

The last question. I give all my points !!! Traduction: Calculate the perimeter of the polygon where a= 58° b=C A= 24.6 Options A) 100.2 m B) 96.4 m C) 78.9 m

ACCESS MORE