shaumik shaumik

20-03-2021
Mathematics

contestada

Work out the equation of the line which has a gradient of 2 and
passes through the point (1, 4).

Respuesta :

tankisfun97 tankisfun97

20-03-2021

Answer:

y = 2x + 2

Step-by-step explanation:

y-4 = 2(x-1)

y= 2x-2+4

y= 2x +2

Answer Link

Otras preguntas

Consider the following chemical reaction of bromothymol blue indicator. It appears yellow in undissociated form and blue in its dissociated aqueous solution. H

excuse the dark the lines but what is the product to this

All animals are: consumers carnivores scavengers omnivores

can anybody help me plz

The molecular mass of octane is 114.22 g/mol. What is the mass of 22.05 mol of octane? 5.180 g 22.05 g 114.22 g 2,518 g

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

The vibrations of the eardrum are amplified by three tiny bones: the malleus, the incus, and the stapes. they are located in the _____________. middle ear cochl

Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those _____.

A garden has the shape of a right triangle with one leg 4 meters longer than the other. the hypotenuse is 4 meters less than twice the length of the shorter leg

Ms. Bergstedt asked two students to come up with two different sequences. Jay created this sequence: The first term is 4 and each term after the first is 6 more

ACCESS MORE