anacristinabahena anacristinabahena

02-03-2021
Mathematics

contestada

simplify: −3−2[4−1].

Respuesta :

rivesjenny29 rivesjenny29

02-03-2021

-3-2 (4-1) simplified is -9

Answer Link

Otras preguntas

Solve for x and y: x-3y=-8 3x+2y=31

Please help me with this

How many meters are there in 21 feet?

Which English reformer called for change in the church during the 1300's

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm

how did world war 2 spur job growth in Washington?A: by decreasing competition in foreign tradeB: by encouraging many people to conserve resourcesC: by increasi

what is the most important factor that holds a gene pool of a species together and prevents speciation?

Find the area of a kite with diagonals 10 & 5

How many neutrons does element X have if its atomic number is 31 and its mass number is 90?