ElhajiYassine4619 ElhajiYassine4619

28-02-2021
Biology

contestada

Pls, I need help with this! Biology Thank you :)

Pls I need help with this Biology Thank you class=

Respuesta :

sammnotfound sammnotfound

28-02-2021

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

Answer Link

Otras preguntas

What is the range of change of the function f(x) =3x-12 for the domain (-2,2)?

_______ is a sleep disorder associated with obesity; it's also implicated in SIDs. A. Sleepwalking B. Chronic insomnia C. Narcolepsy D. Sleep

Which of the following would not be considered a factor in the current, tense, situation in ireland? a. ireland's proximity to england b. a desire for basque

________was the name of franklin delano roosevelt's foreign policy. a. containment policy b. open-door policy c. "big-stick" policy d. "good neighbor" polic

Multiplying an odd number of negative numbers gives an answer that is _______________ choose from: positive negative

answer g(x)=10[(-x)^3+10]

Which european country did japan fight and defeat during a war from 1904-1905? a. france b. germany c. russia d. the netherlands

A backpack has a mass of 8 kg. It is lifted and given 54.9 J of gravitational potential energy. How high is it lifted? Acceleration due to gravity is g = 9.8 m/

The Miller family visited Mama's Kitchen and ordered 4 hamburgers and 3 medium fries and paid $18.69. James ordered a medium drink, a hamburger, and 2 medium fr

Explain how choosing not to smoke can be beneficial to an individual's health.

ACCESS MORE EDU ACCESS