Question

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following
sequence of bases in one strand of the DNA molecule.
AACCTGGCCATGGACCTTTATATAAACTAGGAT
The researcher wants to revise the model to show the transcription of DNA to form mRNA.
Which of these revisions to the model would be most useful for the researcher to include?
O
A Replace thymine (T) with uracil (U) in the DNA molecule.
B
Keep the two strands of the DNA molecule joined together.
C. Identify promoter and "stop" regions on the DNA molecule.
O
D. Divide the DNA molecule into pieces that are 40 to 50 bases long
Review progress
Question 36
of 40
Back
Next →

Answer 1

Correct answer - Replace Thymine (T) with uracil (U) in the DNA molecule.

Why? - As the RNA polymerase continues down the strand of DNA, more nucleotides are added to the mRNA, thereby forming a progressively longer chain of nucleotides. This process is called elongation. DNA (top) includes thymine (red); in RNA (bottom), thymine is replaced with uracil (yellow).

Answer 2

The revisions to the model that would be most useful for the researcher to include is the replacement of thymine (T) with uracil (U) in the DNA molecule.

What do you mean by Transcription?

Transcription may be defined as a process by which DNA is converted into mRNA in the nucleus of the cell.

In RNA, thymine is replaced by Uracil because during the elongation process, the presence of adenine in the DNA strand message the RNA polymerase to attach uracil in the complementary area of the elongated RNA strand.

Apart from this, Uracil requires less energy in the production as compared to thymine.

Therefore, the revisions to the model that would be most useful for the researcher to include is the replacement of thymine (T) with uracil (U) in the DNA molecule.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ2