williamschris1160 williamschris1160

29-01-2021
Mathematics

contestada

A cake recipe uses 3 eggs to make 12 servings. How many eggs will be required to make 348 servings A.4 eggs B. 29 eggs C.87 eggs D.1,392 eggs

Respuesta :

ashlee100 ashlee100

29-01-2021

B. 29

348 divided by 12 equals 29

Answer Link

Otras preguntas

You start out with a cell suspension of 5e6 cells in a 10ml. you want to seed a new flask with half a million cells. how many milliliters of the cell suspension

Militarism lead to the start of World War I because it caused

what are some of T’challa actions btw it from black panther

list the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT

please help asap 25 pts

how to do this ....?

Please help with part B

How do daughter cells obtain their DNA? The DNA in the parent cell nucleus makes a copy of itself and is then split between the two daughter cells during mit

un tema fundamental de la vidad el buscon es? a. el arribismo b. la brujeria c. el amor d. el deseo

Glass may shatter when exposed to sound of a particular frequency. this phenomenon is an example of